{
 "cells": [
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "hello there!"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "# HW 1: Manipulating DNA Data as Strings"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Here is the DNA fragment itself, for subsequent cells. All of the below operations should work on this data."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {
    "collapsed": true
   },
   "outputs": [],
   "source": [
    "dna_frag = \"ATCGATCGATCGATCGACTGAATTCTCATAGCTATGCATGTAGCTACTCGATCGATCGATCGATCGATCGATCGATCGATCGATCATGCTATCATCGATCGATATCGATGCATCGACTACTAT\""
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<h3>Calculating AT content</h3>\n",
    "Here we calculating the fraction of the fragment that is A or T."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {
    "collapsed": true
   },
   "outputs": [],
   "source": []
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<h3>Complementing DNA</h3>\n",
    "Here we calculate the complementary strand of DNA."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {
    "collapsed": true
   },
   "outputs": [],
   "source": []
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<h3>Calculating restriction fragment length</h3>\n",
    "Here we calculate the size of the two subfragments, when we use the EcoRI restriction enzyme to cut the DNA at the motif G\\*AATTC (where the \\* indicates the position of the cut)."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {
    "collapsed": true
   },
   "outputs": [],
   "source": []
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<h3>Splicing out introns</h3>\n",
    "Say the DNA fragment contains two exons, with an intron in between. The first exon contains the first 63 bases (characters), while the last one runs from the 91st (using 1-based counting) character to the end. The intron is the space between them. This program will print out:\n",
    "<ol>\n",
    "  <li>Each exon, separately.</li>\n",
    "  <li>The fraction of DNA that is part of an exon.</li>\n",
    "  <li>The full DNA strand, but the intron will be in lower-case letters.</li>\n",
    "</ol>"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {
    "collapsed": true
   },
   "outputs": [],
   "source": []
  }
 ],
 "metadata": {
  "kernelspec": {
   "display_name": "Python 3",
   "language": "python",
   "name": "python3"
  },
  "language_info": {
   "codemirror_mode": {
    "name": "ipython",
    "version": 3
   },
   "file_extension": ".py",
   "mimetype": "text/x-python",
   "name": "python",
   "nbconvert_exporter": "python",
   "pygments_lexer": "ipython3",
   "version": "3.4.3"
  }
 },
 "nbformat": 4,
 "nbformat_minor": 0
}